or111-11

Ensembl ID:
ENSDARG00000041019
ZFIN ID:
ZDB-GENE-010308-10
Description:
odorant receptor, family D, subfamily 111, member 11 [Source:RefSeq peptide;Acc:NP_571819]
Human Orthologues:
OR2AT4, OR6K2, OR6K3, OR6K6, OR6N1, OR6N2
Human Descriptions:
olfactory receptor, family 2, subfamily AT, member 4 [Source:HGNC Symbol;Acc:19620]
olfactory receptor, family 6, subfamily K, member 2 [Source:HGNC Symbol;Acc:15029]
olfactory receptor, family 6, subfamily K, member 3 [Source:HGNC Symbol;Acc:15030]
olfactory receptor, family 6, subfamily K, member 6 [Source:HGNC Symbol;Acc:15033]
olfactory receptor, family 6, subfamily N, member 1 [Source:HGNC Symbol;Acc:15034]
olfactory receptor, family 6, subfamily N, member 2 [Source:HGNC Symbol;Acc:15035]
Mouse Orthologues:
Olfr231, Olfr420, Olfr421, Olfr424, Olfr427, Olfr429, Olfr430, Olfr520, Olfr521
Mouse Descriptions:
olfactory receptor 231 Gene [Source:MGI Symbol;Acc:MGI:3030065]
olfactory receptor 420 Gene [Source:MGI Symbol;Acc:MGI:3030254]
olfactory receptor 421 Gene [Source:MGI Symbol;Acc:MGI:3030255]
olfactory receptor 424 Gene [Source:MGI Symbol;Acc:MGI:3030258]
olfactory receptor 427 Gene [Source:MGI Symbol;Acc:MGI:3030261]
olfactory receptor 429 Gene [Source:MGI Symbol;Acc:MGI:3030263]
olfactory receptor 430 Gene [Source:MGI Symbol;Acc:MGI:3030264]
olfactory receptor 520 Gene [Source:MGI Symbol;Acc:MGI:3030354]
olfactory receptor 521 Gene [Source:MGI Symbol;Acc:MGI:3030355]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22676 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060111 Nonsense 156 325 2 2
Genomic Location (Zv9):
Chromosome 15 (position 30716601)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31538308
KASP Assay ID:
2260-8704.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCTATTGTCAACAACACAGTCATATCTGTAGTGTTTTTAGTTTTATG[G/A]GCGTTTAATGTTTTTGTGCTTCTGGTTGTGGTGGGTATGATCACTCGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link