cttnbp2

Ensembl ID:
ENSDARG00000040991
ZFIN ID:
ZDB-GENE-030131-8134
Description:
Novel protein containing ankyrin repeats [Source:UniProtKB/TrEMBL;Acc:Q1LX68]
Human Orthologue:
CTTNBP2
Human Description:
cortactin binding protein 2 [Source:HGNC Symbol;Acc:15679]
Mouse Orthologue:
Cttnbp2
Mouse Description:
cortactin binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1353467]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11049 Nonsense Available for shipment Available now
sa17017 Nonsense Available for shipment Available now
sa10059 Essential Splice Site Available for shipment Available now
sa8747 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11049
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100743 Nonsense 201 1573 4 23
ENSDART00000143233 Nonsense 174 1427 3 19
Genomic Location:
Chromosome 18 (position 20549891)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGGTCGAAGAGAACCAGCGCTTTGAGGAACTTTCGTCCCRTACTGAG[C/T]AGGATGGTCGATCRGTGGGACGTCWGGAAGARGAACTGGCATCTGAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17017
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100743 Nonsense 502 1573 4 23
ENSDART00000143233 Nonsense 475 1427 3 19
Genomic Location:
Chromosome 18 (position 20548988)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTGTGGCCCGAATCGAMAGGGRTAACCCACCCCCGATCCCACCAAAA[A/T]AACCTGGACTGTCCCAGACACCRTCCCCTCCACACCCACCAATTAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100743 Essential Splice Site 774 1573 7 23
ENSDART00000143233 Essential Splice Site 747 1427 6 19
Genomic Location:
Chromosome 18 (position 20541044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAAAGTGTTGTTAGACGCAGGAGCAGACCGAACACACGTTACCACTG[T/C]GAGTTTGCAGCAGTGTTGCTCAAATGTCAATTACACACTGYGTTAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100743 Nonsense 1300 1573 18 23
ENSDART00000143233 Nonsense 1269 1427 17 19
Genomic Location:
Chromosome 18 (position 20516123)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTYGAGGACGCTGTTATATCGAGAGTAACAGCCAAACGCTCTCCCTCR[C/T]AGCGACGGTCCCCCAACAGCAAAGCTCTGACCCCGGGCCARAGAGCAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u8o67mkn