itgbl1

Ensembl ID:
ENSDARG00000040985
ZFIN ID:
ZDB-GENE-050522-410
Description:
integrin beta-like protein 1 [Source:RefSeq peptide;Acc:NP_001019243]
Human Orthologue:
ITGBL1
Human Description:
integrin, beta-like 1 (with EGF-like repeat domains) [Source:HGNC Symbol;Acc:6164]
Mouse Orthologue:
Itgbl1
Mouse Description:
integrin, beta-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443439]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41453 Essential Splice Site Mutation detected in F1 DNA During 2017
sa41454 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060054 Essential Splice Site 31 406 1 8
ENSDART00000139584   None 186 None 5
Genomic Location (Zv9):
Chromosome 9 (position 32786160)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31942106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCATCTTGCTCTCTGCCATTCGAGGAAGTTTACAGCAGTCGCTAAGG[T/G]GAGTTTAAGCTGTGTTGTTTTCTTAAACCAATTTGGCTTTTCCACTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41454
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060054 Essential Splice Site 148 406 3 8
ENSDART00000139584   None 186 None 5
Genomic Location (Zv9):
Chromosome 9 (position 32815753)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 31971699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAAGACCTCTGCCGCAATGCTCAGGGTGTAGTTTGCTCCAATGCAGG[T/C]AAGATACACATCACCCAGAGACTTATAGTGTTGAGAAAGGCATACAGTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link