hspa13

Ensembl ID:
ENSDARG00000040984
ZFIN ID:
ZDB-GENE-070410-58
Description:
heat shock 70 kDa protein 13 [Source:RefSeq peptide;Acc:NP_001082948]
Human Orthologue:
HSPA13
Human Description:
heat shock protein 70kDa family, member 13 [Source:HGNC Symbol;Acc:11375]
Mouse Orthologue:
Hspa13
Mouse Description:
heat shock protein 70 family, member 13 Gene [Source:MGI Symbol;Acc:MGI:1309463]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15986 Nonsense Available for shipment Available now
sa28474 Nonsense Mutation detected in F1 DNA During 2015
sa16121 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060049 Nonsense 23 438 2 5

The following transcripts of ENSDARG00000040984 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 28905042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCCAGGTTCTGTCATCCTGGCTCTACTTCTRGCTGGGTATCTGGGA[C/T]AGCAGTATCTACCGCCTCCAAAGCCCAGGGTCATTGGGCTGGATCTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060049 Nonsense 133 438 3 5

The following transcripts of ENSDARG00000040984 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 28904640)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCATTGCTATTTTGCAGGTGATATTCAACAATGGCAGTGCAGATTTTT[T/A]AGTCAATACAAACAGCACTTTCACGGTTACTCCTGAATTTATCGGATCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060049 Nonsense 421 438 5 5

The following transcripts of ENSDARG00000040984 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 28898834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCGGTGTGGCCATTCAGGCAGGCATTATGGGTGGTTCTTGGCCTCTT[C/T]AAGTCAGTGCAATTGAAATTCCCAATAGACATCTTCGCAAGACTAACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/omldy4b2