hspa13

Ensembl ID:
ENSDARG00000040984
ZFIN ID:
ZDB-GENE-070410-58
Description:
heat shock 70 kDa protein 13 [Source:RefSeq peptide;Acc:NP_001082948]
Human Orthologue:
HSPA13
Human Description:
heat shock protein 70kDa family, member 13 [Source:HGNC Symbol;Acc:11375]
Mouse Orthologue:
Hspa13
Mouse Description:
heat shock protein 70 family, member 13 Gene [Source:MGI Symbol;Acc:MGI:1309463]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15986 Nonsense Available for shipment Available now
sa16121 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15986
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060049 Nonsense 23 438 2 5

The following transcripts of ENSDARG00000040984 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 28905042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTCCAGGTTCTGTCATCCTGGCTCTACTTCTRGCTGGGTATCTGGGA[C/T]AGCAGTATCTACCGCCTCCAAAGCCCAGGGTCATTGGGCTGGATCTTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16121
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060049 Nonsense 421 438 5 5

The following transcripts of ENSDARG00000040984 do not overlap with this mutation:

Genomic Location:
Chromosome 15 (position 28898834)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCGGTGTGGCCATTCAGGCAGGCATTATGGGTGGTTCTTGGCCTCTT[C/T]AAGTCAGTGCAATTGAAATTCCCAATAGACATCTTCGCAAGACTAACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/omldy4b2