fgf14

Ensembl ID:
ENSDARG00000040982
ZFIN ID:
ZDB-GENE-060506-1
Description:
fibroblast growth factor 14 [Source:RefSeq peptide;Acc:NP_001012382]
Human Orthologue:
FGF14
Human Description:
fibroblast growth factor 14 [Source:HGNC Symbol;Acc:3671]
Mouse Orthologue:
Fgf14
Mouse Description:
fibroblast growth factor 14 Gene [Source:MGI Symbol;Acc:MGI:109189]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11251 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060051 Nonsense 103 248 3 5
Genomic Location:
Chromosome 9 (position 32921540)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGTAAATGTGAATTAATATATTTGTTAACCCATTGTTTTTACAGCGT[T/A]GTTCAACCTCATCCCTGTGGGCCTTCGGGTCGTTGCTATTCAGTCTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y1a8f6t2