rabl3

Ensembl ID:
ENSDARG00000040959
ZFIN ID:
ZDB-GENE-040808-11
Description:
Rab-like protein 3 [Source:UniProtKB/Swiss-Prot;Acc:Q6TNS7]
Human Orthologue:
RABL3
Human Description:
RAB, member of RAS oncogene family-like 3 [Source:HGNC Symbol;Acc:18072]
Mouse Orthologue:
Rabl3
Mouse Description:
RAB, member of RAS oncogene family-like 3 Gene [Source:MGI Symbol;Acc:MGI:1914907]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14541 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060024 Essential Splice Site 102 245 None 8
ENSDART00000123466 Essential Splice Site 90 137 None 8
ENSDART00000136136 Essential Splice Site 90 233 None 8

The following transcripts of ENSDARG00000040959 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 33683096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCAGCAGTGTTAAAAGCACCAGAGCTGTGYTTTACAATTCAGTTAATGG[T/G]TAAGTATYARTGTTCCCCTTTGAACACAATATATTTTATTACGAGAAACW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aurr4og3