olig1

Ensembl ID:
ENSDARG00000040948
ZFIN ID:
ZDB-GENE-050107-2
Description:
oligodendrocyte transcription factor 1 [Source:RefSeq peptide;Acc:NP_001018632]
Human Orthologue:
OLIG1
Human Description:
oligodendrocyte transcription factor 1 [Source:HGNC Symbol;Acc:16983]
Mouse Orthologue:
Olig1
Mouse Description:
oligodendrocyte transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1355334]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21519 Nonsense Available for shipment Available now
sa31728 Nonsense Available for shipment Available now
sa34682 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060011 Nonsense 64 235 1 1
ENSDART00000147795 Nonsense 64 235 2 2
Genomic Location (Zv9):
Chromosome 9 (position 33763045)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32918991
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAACCTCCTCGAGAGCTTAGTTCGGAGGAGCAACAGGAGCTGCGGAGG[A/T]AGATCAACAGCCGTGAAAGGAAGAGAATGCAGGACCTCAATGTGGCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060011 Nonsense 83 235 1 1
ENSDART00000147795 Nonsense 83 235 2 2
Genomic Location (Zv9):
Chromosome 9 (position 33762987)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32918933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCCGTGAAAGGAAGAGAATGCAGGACCTCAATGTGGCCATGGATGCTT[T/A]ACGGGAAGTCATGGTGCCCTACTCCTCTTCTCCCACCGGTGTAGGGGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34682
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060011 Nonsense 235 235 1 1
ENSDART00000147795 Nonsense 235 235 2 2
Genomic Location (Zv9):
Chromosome 9 (position 33762532)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32918478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTCGGACACCCCGGGTGGTGCATGTTAATCCAGCCATGCGTTTTCCG[A/T]AGTGATTCCATCATGCCTTGGAGAAAGGCTAACAAAAGACAATGCAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link