ntd5

Ensembl ID:
ENSDARG00000040944
ZFIN ID:
ZDB-GENE-031030-7
Description:
Ntd5 protein [Source:UniProtKB/TrEMBL;Acc:A7MD90]
Human Orthologue:
APOH
Human Description:
apolipoprotein H (beta-2-glycoprotein I) [Source:HGNC Symbol;Acc:616]
Mouse Orthologue:
Apoh
Mouse Description:
apolipoprotein H Gene [Source:MGI Symbol;Acc:MGI:88058]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13886 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13886
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060004 Essential Splice Site 136 361 4 8
ENSDART00000127905 Essential Splice Site 193 418 4 8
Genomic Location (Zv9):
Chromosome 16 (position 15330949)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13689408
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCAAATGCTCAAAATAAGAGATAAACAAGTTATTTTGATTTTCCCWTC[A/G]GCCCCCCCAGGYGGAGATGTTTCAGCAGGGCCGGGTCTGRTGCCTGATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link