pnp6

Ensembl ID:
ENSDARG00000040942
ZFIN ID:
ZDB-GENE-040426-1800
Description:
nucleoside phosphorylase-like [Source:RefSeq peptide;Acc:NP_991218]
Human Orthologue:
PNP
Human Description:
purine nucleoside phosphorylase [Source:HGNC Symbol;Acc:7892]
Mouse Orthologues:
Pnp, Pnp2
Mouse Descriptions:
purine-nucleoside phosphorylase 2 Gene [Source:MGI Symbol;Acc:MGI:3712328]
purine-nucleoside phosphorylase Gene [Source:MGI Symbol;Acc:MGI:97365]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36643 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36643
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060001 Essential Splice Site 8 286 1 6
ENSDART00000136285   None 129 None 3
Genomic Location (Zv9):
Chromosome 18 (position 21051755)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 21281978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTAATTCGACCAGCCGCTGCGGACATGTCAACATCCAGCGAATGCAGG[T/C]AAGATGAAAAACGAAAAGCATATAGGCTGTGTGTTCAGTTCGCTGCATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link