si:dkey-188l8.4

Ensembl ID:
ENSDARG00000040938
ZFIN ID:
ZDB-GENE-050208-558
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LUM2]
Human Orthologue:
C3orf32
Human Description:
chromosome 3 open reading frame 32 [Source:HGNC Symbol;Acc:24809]
Mouse Orthologue:
D630042P16Rik
Mouse Description:
RIKEN cDNA D630042P16 gene Gene [Source:MGI Symbol;Acc:MGI:2443733]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24203 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059997 Nonsense 226 300 8 9
ENSDART00000139887   None 103 None 3
Genomic Location (Zv9):
Chromosome 22 (position 33630160)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30991698
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTATATATTTTAAGGCATAATGCATGTTTGCAGGTTTATCCGATACAG[G/T]GATTTCCTGACCATGACATTTGTGATGCCTCAAAAGGAGCAATTCAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link