depdc6

Ensembl ID:
ENSDARG00000040930
ZFIN ID:
ZDB-GENE-061013-453
Description:
DEP domain-containing mTOR-interacting protein [Source:RefSeq peptide;Acc:NP_001070788]
Human Orthologue:
DEPDC6
Human Description:
DEP domain containing 6 [Source:HGNC Symbol;Acc:22953]
Mouse Orthologue:
Depdc6
Mouse Description:
DEP domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2146322]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28614 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28614
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059984 Essential Splice Site None 348 1 10
ENSDART00000133566 Essential Splice Site None 115 1 4
ENSDART00000140469 Essential Splice Site None 407 1 10
Genomic Location (Zv9):
Chromosome 16 (position 16883477)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 14698338
KASP Assay ID:
2260-9400.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTATTGTTCTGCGAAGCATAAGACTGAGGTTTCTGCATCGGAACCAAG[G/A]TAAATATTCTCGTCGCTTGCTTGTTTGTTTCGATGTCCTTTAACTTATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link