LOC100334365

Ensembl ID:
ENSDARG00000040928
Human Orthologues:
CLDN17, CLDN8
Human Descriptions:
claudin 17 [Source:HGNC Symbol;Acc:2038]
claudin 8 [Source:HGNC Symbol;Acc:2050]
Mouse Orthologues:
Cldn17, Cldn8
Mouse Descriptions:
claudin 17 Gene [Source:MGI Symbol;Acc:MGI:2652030]
claudin 8 Gene [Source:MGI Symbol;Acc:MGI:1859286]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32794 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32794
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059982 Nonsense 165 217 1 1
Genomic Location (Zv9):
Chromosome 1 (position 56989538)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 55773371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCCGAATGTGCCTCCAGTGCTGAAGCGAGAGCTCGGCCCCGCCCTATA[C/A]CTAGGCTGGGTGGTGGCGCTGCTCATGCTGGTGGGCGGAGCTCTGATGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link