nr2f2

Ensembl ID:
ENSDARG00000040926
ZFIN IDs:
ZDB-GENE-000112-36, ZDB-GENE-000112-36, ZDB-GENE-000112-36, ZDB-GENE-990415-252
Description:
COUP transcription factor 2 [Source:RefSeq peptide;Acc:NP_571258]
Human Orthologue:
NR2F2
Human Description:
nuclear receptor subfamily 2, group F, member 2 [Source:HGNC Symbol;Acc:7976]
Mouse Orthologue:
Nr2f2
Mouse Description:
nuclear receptor subfamily 2, group F, member 2 Gene [Source:MGI Symbol;Acc:MGI:1352452]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18083 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18083
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059976 Nonsense 83 428 1 3
ENSDART00000130163 Nonsense 83 422 1 3
ENSDART00000133361   None 49 None 6
ENSDART00000134910 Nonsense 44 140 1 2
Genomic Location (Zv9):
Chromosome 18 (position 23658496)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 23888269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACCCCGACGAACCAGACGACGCAGAGCCARTCGGAAAAGCAGCAGCCA[C/T]AGCATMTAGAGTGCGTGGTTTGCGGGGACAAATCCAGCGGTAAACACTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link