ENSDARG00000040921

Ensembl ID:
ENSDARG00000040921
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11759 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059970 Nonsense 195 1804 2 4
Genomic Location:
Chromosome 22 (position 33318921)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATAGGAGACCTGATGAAGAAGATAGAGCAACTSTTTATTGATAATGAC[C/T]AGCAGTTTTACACCAATGAAGATGTGCAAAACAGGATATGTCAAAGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/07bh9wq6