cbfb

Ensembl ID:
ENSDARG00000040917
ZFIN ID:
ZDB-GENE-980526-440
Description:
core-binding factor subunit beta [Source:RefSeq peptide;Acc:NP_954679]
Human Orthologue:
CBFB
Human Description:
core-binding factor, beta subunit [Source:HGNC Symbol;Acc:1539]
Mouse Orthologue:
Cbfb
Mouse Description:
core binding factor beta Gene [Source:MGI Symbol;Acc:MGI:99851]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5910 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059961 Essential Splice Site 55 187 2 6

The following transcripts of ENSDARG00000040917 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 22775919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGCAGGCGCGCTTCCAGAACGCGTGCCGTGACGGCCGCTCAGAGATAG[T/C]GAGTACACGCACCTCACAGCACCGGACAATTACAACACTGACCCTGCGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/31hwmgn3