si:ch73-113g13.1

Ensembl ID:
ENSDARG00000040902
ZFIN ID:
ZDB-GENE-091204-462

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43111 Nonsense Mutation detected in F1 DNA During 2017
sa13244 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059945 Nonsense 84 339 1 4
ENSDART00000142185 Nonsense 54 271 1 1
Genomic Location (Zv9):
Chromosome 18 (position 22498115)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22728338
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACATTTTGTGCTGTTTGGAATTATATTTGGATGGAAATTTGGCCTGTG[G/A]TTTTGTAGGTTCCTATTTTTCATGGGTCACTGGAGTCTGTATGTTGGCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059945 Nonsense 200 339 2 4
ENSDART00000142185 Nonsense 181 271 1 1
Genomic Location (Zv9):
Chromosome 18 (position 22497735)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22727958
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCATGTTGACADGTTATCTGTGGCTGCATAAAGGTTTGAGTCAAAAYT[C/A]AACYTTMCCKAGAGCTTCACAGGAGCAGGAATCCAGAAACAAGGGGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link