si:dkey-11d18.4

Ensembl ID:
ENSDARG00000040901
ZFIN ID:
ZDB-GENE-091204-474

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13243 Nonsense Available for shipment Available now
sa23306 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13243
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100955 Nonsense 114 311 1 2
ENSDART00000147183 Nonsense 62 253 1 1
Genomic Location (Zv9):
Chromosome 18 (position 22476698)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22706921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTRACGGTTACGTCAATGAGTGTGCACCRCTATCACAATGTCATCAAGT[C/A]AAGGGTCACTAATAGGACRATTCTGCACAGACTGGAGCGACGACACAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100955 Nonsense 155 311 1 2
ENSDART00000147183 Nonsense 103 253 1 1
Genomic Location (Zv9):
Chromosome 18 (position 22476576)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22706799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACTCTCGCCTTTGTTTTTGCCCTACCAGTTTATTTTACTCAAGAACTT[A/T]AAGACAAAGATGGATTCCAAAGATGTCAGAGGACAATGAGCTCAATGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link