gpa33

Ensembl ID:
ENSDARG00000040898
ZFIN ID:
ZDB-GENE-070912-194
Human Orthologues:
C1orf204, GPA33
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
glycoprotein A33 (transmembrane) [Source:HGNC Symbol;Acc:4445]
Mouse Orthologue:
Gpa33
Mouse Description:
glycoprotein A33 (transmembrane) Gene [Source:MGI Symbol;Acc:MGI:1891703]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3703 Nonsense Mutation detected in F1 DNA During 2014
sa7199 Nonsense Mutation detected in F1 DNA During 2014
sa14242 Nonsense Available for shipment Available now
sa10979 Nonsense Available for shipment Available now
sa15629 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 36 484 2 7
ENSDART00000137806 None None 164 None 3
Genomic Location:
Chromosome 9 (position 35281125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACTTTTGGACTGGAAGTGACAATGAGTGAAGCATCCATGGAGGTTGCC[A/T]GAGGTGATGATGTCAGACTGACGTGTAATTTTAAACCTAAGAAACCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 118 484 3 7
ENSDART00000137806 Nonsense 47 164 1 3
Genomic Location:
Chromosome 9 (position 35279279)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAAAAACATCAACGCTAACAATAAAGCAAGTCACTCAGAAGGWAAGC[A/T]GAAAAATTAGATGTTATGTTCAGATCCCTGGAGACATCGAAGGCAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 121 484 3 7
ENSDART00000137806 Nonsense 50 164 1 3
Genomic Location:
Chromosome 9 (position 35279270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAACGCTAACAATAAAGCAAGTCACTCAGAAGGWAAGCWGAAAAATT[A/T]GATGTTATGTTCAGATCCCTGGAGACATCGAAGGCAAACCAGCAGACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 375 484 7 7
ENSDART00000137806 None None 164 None 3
Genomic Location:
Chromosome 9 (position 35274313)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACTGARAGATCGATACGAGGATCGAAGAGGAAGTCGTGATGAACTT[A/T]GAGATYGCTAYGAGGATCGCARAGGAAGTCGTGATGAACTTAGAGATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 445 484 7 7
ENSDART00000137806 None None 164 None 3
Genomic Location:
Chromosome 9 (position 35274103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACTAAGAGAACGCTATGATGACCGCAGAGATCAATATGATGACCGT[A/T]GAGATCWTTATGATGATCGTAGAGGTAGTCGTGATGATCTTAGAGATCGK
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2yqqsbgb