gpa33

Ensembl ID:
ENSDARG00000040898
ZFIN ID:
ZDB-GENE-070912-194
Human Orthologues:
C1orf204, GPA33
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
glycoprotein A33 (transmembrane) [Source:HGNC Symbol;Acc:4445]
Mouse Orthologue:
Gpa33
Mouse Description:
glycoprotein A33 (transmembrane) Gene [Source:MGI Symbol;Acc:MGI:1891703]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7199 Nonsense Mutation detected in F1 DNA During 2016
sa14242 Nonsense Available for shipment Available now
sa41469 Nonsense Mutation detected in F1 DNA During 2016
sa10979 Nonsense Available for shipment Available now
sa15629 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 118 484 3 7
ENSDART00000137806 Nonsense 47 164 1 3
Genomic Location (Zv9):
Chromosome 9 (position 35279279)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34498790
KASP Assay ID:
554-4781.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAAAAACATCAACGCTAACAATAAAGCAAGTCACTCAGAAGGWAAGC[A/T]GAAAAATTAGATGTTATGTTCAGATCCCTGGAGACATCGAAGGCAAACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 121 484 3 7
ENSDART00000137806 Nonsense 50 164 1 3
Genomic Location (Zv9):
Chromosome 9 (position 35279270)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34498781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCAACGCTAACAATAAAGCAAGTCACTCAGAAGGWAAGCWGAAAAATT[A/T]GATGTTATGTTCAGATCCCTGGAGACATCGAAGGCAAACCAGCAGACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 315 484 7 7
ENSDART00000137806   None 164 None 3
Genomic Location (Zv9):
Chromosome 9 (position 35274493)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34494004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGAACACAGACACCATAGCAATCACTGACGAGAGAACTGGCAAGGCC[C/T]GAAATGATGATTTTGAAGATCGGTATGATGACAGTGGAAGTGGCCGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 375 484 7 7
ENSDART00000137806   None 164 None 3
Genomic Location (Zv9):
Chromosome 9 (position 35274313)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34493824
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACTGARAGATCGATACGAGGATCGAAGAGGAAGTCGTGATGAACTT[A/T]GAGATYGCTAYGAGGATCGCARAGGAAGTCGTGATGAACTTAGAGATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059939 Nonsense 445 484 7 7
ENSDART00000137806   None 164 None 3
Genomic Location (Zv9):
Chromosome 9 (position 35274103)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 34493614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAACTAAGAGAACGCTATGATGACCGCAGAGATCAATATGATGACCGT[A/T]GAGATCWTTATGATGATCGTAGAGGTAGTCGTGATGATCTTAGAGATCGK
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link