bmper

Ensembl ID:
ENSDARG00000040893
ZFIN IDs:
ZDB-GENE-030219-146, ZDB-GENE-030219-146
Description:
BMP-binding endothelial regulator protein [Source:RefSeq peptide;Acc:NP_001018323]
Human Orthologue:
BMPER
Human Description:
BMP binding endothelial regulator [Source:HGNC Symbol;Acc:24154]
Mouse Orthologue:
Bmper
Mouse Description:
BMP-binding endothelial regulator Gene [Source:MGI Symbol;Acc:MGI:1920480]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30999 Nonsense Mutation detected in F1 DNA During 2017
sa36040 Essential Splice Site Mutation detected in F1 DNA During 2017
sa108 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30999
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059930 Nonsense 201 663 11 20
ENSDART00000097348 Nonsense 205 667 7 16
Genomic Location (Zv9):
Chromosome 16 (position 9274646)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7230774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTCCTGTTCTGTCCTGCCCGTCTCATCTTACCCACACTCCACCTGGC[C/T]AGTGCTGTCCAAGATGTCGGGGTGAGTTATTTCCTTACAGATGTTCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36040
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059930 Essential Splice Site 340 663 14 20
ENSDART00000097348 Essential Splice Site 344 667 10 16
Genomic Location (Zv9):
Chromosome 16 (position 9267738)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7237682
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATAAGATACTGAATCGCACTGGCTGCTGTCCTGTTTGCACTGACAG[T/C]AAGTTGACTTCTTTACACGACACTCTTATTGGAATCTTAAAAACGAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa108
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059930 Nonsense 545 663 16 20
ENSDART00000097348 Nonsense 549 667 12 16
Genomic Location (Zv9):
Chromosome 16 (position 9261799)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 7243621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCAAGGTGAAGCTCCGCGCTCACAGAACCTGCCAGAAGCTCAAGTCCT[G/A]GGAGTTTCAGAAGTGCCACTCTGCTGTCGACTTTACCTCCTTTTACAAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link