add3a

Ensembl ID:
ENSDARG00000040874
ZFIN ID:
ZDB-GENE-030131-2721
Description:
gamma-adducin [Source:RefSeq peptide;Acc:NP_955957]
Human Orthologue:
ADD3
Human Description:
adducin 3 (gamma) [Source:HGNC Symbol;Acc:245]
Mouse Orthologue:
Add3
Mouse Description:
adducin 3 (gamma) Gene [Source:MGI Symbol;Acc:MGI:1351615]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4172 Nonsense Mutation detected in F1 DNA During 2014
sa819 Nonsense Available for shipment Available now
sa11322 Nonsense Available for shipment Available now
sa19300 Nonsense Mutation detected in F1 DNA During 2014
sa11284 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 63 644 1 15
ENSDART00000040538 Nonsense 63 672 5 18
ENSDART00000049075 Nonsense 63 645 2 14
ENSDART00000140015 Nonsense 63 239 3 7
ENSDART00000141247 Nonsense 63 64 5 5
ENSDART00000142857 Nonsense 63 103 4 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 32885145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAAGACTTCAACATGAWGGAGCAGAAGAAGAGGGTCACACAGATACTA[C/T]AGAGTCCAGTAAGGAAACACACACACATTGTGAAMTAAAGTAATGGAYAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 336 644 8 15
ENSDART00000040538 Nonsense 336 672 12 18
ENSDART00000049075 Nonsense 336 645 9 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 32932974)
KASP Assay ID:
554-0723.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGGTGAATGCRTTCTCCTGTGCTGGAGGAATGGAGAACCTGATCGTGT[T/A]GGATCTGGAGAAGTTTAAAGCTCGTACRCAGGGAGTGGCACAAGTTGGAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11322
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 32938787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGTGTYTTATAGACGTSTGTGNTTTTTTTTCCYGTCTTCCAGGGATA[C/A]AGGACTGGCTACACATACCGGCACCCCATCGTGCGGGAGAAACCCCGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19300
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 32938787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGTGTTTTATAGACGTGTGTGTTTTTTTTTCCCGTCTTCCAGGGATA[C/A]AGGACTGGCTACACATACCGGCACCCCATCGTGCGGGAGAAACCCCGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11284
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5
ENSDART00000027803 Nonsense 380 644 9 15
ENSDART00000040538 Nonsense 380 672 13 18
ENSDART00000049075 Nonsense 380 645 10 14
ENSDART00000140015 None None 239 None 7
ENSDART00000141247 None None 64 None 5
ENSDART00000142857 None None 103 None 5

The following transcripts of ENSDARG00000040874 do not overlap with this mutation:

Genomic Location:
Chromosome 22 (position 32938787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTGTGTYTTATAGACGTSTGTGNTTTTTTTTCCYGTCTTCCAGGGATA[C/A]AGGACTGGCTACACATACCGGCACCCCATCGTGCGGGAGAAACCCCGACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Biliary atresia: Genome-wide association study identifies a susceptibility locus for biliary atresia on 10q24.2. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/51hw37zt