upp1

Ensembl ID:
ENSDARG00000040869
ZFIN ID:
ZDB-GENE-050306-2
Description:
uridine phosphorylase 1 [Source:RefSeq peptide;Acc:NP_001013319]
Human Orthologue:
UPP1
Human Description:
uridine phosphorylase 1 [Source:HGNC Symbol;Acc:12576]
Mouse Orthologue:
Upp1
Mouse Description:
uridine phosphorylase 1 Gene [Source:MGI Symbol;Acc:MGI:1097668]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17434 Essential Splice Site Available for shipment Available now
sa22791 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059905 Essential Splice Site 13 233 2 6
ENSDART00000103814 Essential Splice Site 21 315 1 7
Genomic Location:
Chromosome 16 (position 18263094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAACAGAAAATGCCGCTGGGTGAAGAGAAAAACGGAAAATGCGACGG[G/A]TAWGTAAAAAATCTGTCTTTTCCTCAAWGTGAATGGACCTTCAGTCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059905 None None 233 None 6
ENSDART00000103814 Nonsense 239 315 6 7
Genomic Location:
Chromosome 16 (position 18256131)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTGGATGGTGCCTTCTGCTCATACAGTGAAGAAGATAAACAGAACTA[T/A]CTTGCTGAAGCCTATGCTGCTGGGGTTCGCAATATTGAGATGGAATCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/65z63xsy