upp1

Ensembl ID:
ENSDARG00000040869
ZFIN ID:
ZDB-GENE-050306-2
Description:
uridine phosphorylase 1 [Source:RefSeq peptide;Acc:NP_001013319]
Human Orthologue:
UPP1
Human Description:
uridine phosphorylase 1 [Source:HGNC Symbol;Acc:12576]
Mouse Orthologue:
Upp1
Mouse Description:
uridine phosphorylase 1 Gene [Source:MGI Symbol;Acc:MGI:1097668]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17434 Essential Splice Site Available for shipment Available now
sa36076 Nonsense Mutation detected in F1 DNA During 2016
sa22791 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059905 Essential Splice Site 13 233 2 6
ENSDART00000103814 Essential Splice Site 21 315 1 7
Genomic Location (Zv9):
Chromosome 16 (position 18263094)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16304331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAACAGAAAATGCCGCTGGGTGAAGAGAAAAACGGAAAATGCGACGG[G/A]TAWGTAAAAAATCTGTCTTTTCCTCAAWGTGAATGGACCTTCAGTCCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059905 Nonsense 59 233 4 6
ENSDART00000103814 Nonsense 67 315 3 7
Genomic Location (Zv9):
Chromosome 16 (position 18262448)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16303685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTGGATGTACGTTTTGTCTCAGTTTGTGTGTGTAGGGGGAAGTCCATG[G/A]AGGATGAAATCTTTCACTGAATACATTGCCAAAGAACTGGGACTGGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059905   None 233 None 6
ENSDART00000103814 Nonsense 239 315 6 7
Genomic Location (Zv9):
Chromosome 16 (position 18256131)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16297368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCTGGATGGTGCCTTCTGCTCATACAGTGAAGAAGATAAACAGAACTA[T/A]CTTGCTGAAGCCTATGCTGCTGGGGTTCGCAATATTGAGATGGAATCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link