
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tcf25
- Ensembl ID:
- ENSDARG00000040861
- ZFIN ID:
- ZDB-GENE-040905-2
- Description:
- transcription factor 25 [Source:RefSeq peptide;Acc:NP_001005399]
- Human Orthologue:
- TCF25
- Human Description:
- transcription factor 25 (basic helix-loop-helix) [Source:HGNC Symbol;Acc:29181]
- Mouse Orthologue:
- Tcf25
- Mouse Description:
- transcription factor 25 (basic helix-loop-helix) Gene [Source:MGI Symbol;Acc:MGI:1914105]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa23323 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa23323
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059893 | Nonsense | 34 | 650 | 1 | 18 |
ENSDART00000138403 | None | 269 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 18 (position 31006175)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 31139120 GRCz11 18 31117452 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGTGTTACAAGAGCACGAGCTTATTAAGGAAGATGACAAAGATGAAGAA[G/T]AGCAGATGAAGATTGCCGAACAAACAACCCGTAAACCGAGGAACTTCAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: