tcf25

Ensembl ID:
ENSDARG00000040861
ZFIN ID:
ZDB-GENE-040905-2
Description:
transcription factor 25 [Source:RefSeq peptide;Acc:NP_001005399]
Human Orthologue:
TCF25
Human Description:
transcription factor 25 (basic helix-loop-helix) [Source:HGNC Symbol;Acc:29181]
Mouse Orthologue:
Tcf25
Mouse Description:
transcription factor 25 (basic helix-loop-helix) Gene [Source:MGI Symbol;Acc:MGI:1914105]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23323 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059893 Nonsense 34 650 1 18
ENSDART00000138403 None None 269 None 7
Genomic Location:
Chromosome 18 (position 31006175)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGTTACAAGAGCACGAGCTTATTAAGGAAGATGACAAAGATGAAGAA[G/T]AGCAGATGAAGATTGCCGAACAAACAACCCGTAAACCGAGGAACTTCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a12zos2c