btr26

Ensembl ID:
ENSDARG00000040860
ZFIN IDs:
ZDB-GENE-020620-2, ZDB-GENE-070705-377, ZDB-GENE-070705-378
Description:
bloodthirsty [Source:RefSeq peptide;Acc:NP_001018311]
Human Orthologues:
CTD-2611O12.2, CTD-2611O12.3, ERMAP, RFPL1, RFPL2, RFPL3, RFPL4A, RFPL4B
Human Descriptions:
erythroblast membrane-associated protein (Scianna blood group) [Source:HGNC Symbol;Acc:15743]
ret finger protein-like 1 [Source:HGNC Symbol;Acc:9977]
ret finger protein-like 2 [Source:HGNC Symbol;Acc:9979]
ret finger protein-like 3 [Source:HGNC Symbol;Acc:9980]
ret finger protein-like 4A [Source:HGNC Symbol;Acc:16449]
ret finger protein-like 4B [Source:HGNC Symbol;Acc:33264]
Mouse Orthologues:
Ermap, Rfpl4
Mouse Descriptions:
erythroblast membrane-associated protein Gene [Source:MGI Symbol;Acc:MGI:1349816]
ret finger protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2149590]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29134 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39224 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007454   None 559 None 7
ENSDART00000059894   None 532 None 6
ENSDART00000092911 Essential Splice Site 365 557 6 8
ENSDART00000105111 Essential Splice Site 134 326 3 5
ENSDART00000147590   None 532 None 7

The following transcripts of ENSDARG00000040860 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 4859534)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4133095
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTCAGTAAACTGAAGGACACTCTAAATGAGAAACTCAGTCAAACTGG[T/A]ATGTCAATATCAAATAAAATTTTATTTAAGTACTGGAGAATGAGTCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007454   None 559 None 7
ENSDART00000059894 Nonsense 195 532 2 6
ENSDART00000092911   None 557 None 8
ENSDART00000105111   None 326 None 5
ENSDART00000147590 Nonsense 195 532 3 7

The following transcripts of ENSDARG00000040860 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 4864039)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4137600
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTGTTCTCTGTCTCTAGACTGAACTGATGAAGACACAGAAAGACGTG[C/T]AGCAGATGATCGAGGACAGAATCAAGAAGATTCAAGACATCAAACACTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link