ldha

Ensembl ID:
ENSDARG00000040856
ZFIN ID:
ZDB-GENE-991026-5
Description:
L-lactate dehydrogenase A chain [Source:UniProtKB/Swiss-Prot;Acc:Q9PVK5]
Human Orthologues:
LDHA, LDHAL6A, LDHAL6B, LDHC
Human Descriptions:
lactate dehydrogenase A [Source:HGNC Symbol;Acc:6535]
lactate dehydrogenase A-like 6A [Source:HGNC Symbol;Acc:28335]
lactate dehydrogenase A-like 6B [Source:HGNC Symbol;Acc:21481]
lactate dehydrogenase C [Source:HGNC Symbol;Acc:6544]
Mouse Orthologues:
Ldha, Ldhc
Mouse Descriptions:
lactate dehydrogenase A Gene [Source:MGI Symbol;Acc:MGI:96759]
lactate dehydrogenase C Gene [Source:MGI Symbol;Acc:MGI:96764]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4317 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16917 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4317
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059886 Essential Splice Site 43 333 2 8
Genomic Location:
Chromosome 25 (position 25756687)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGTTGGAATGGTWGGAATGGCTGCCGCCGTCAGCATCCTTCTCAAGG[T/G]CAGTGAGGTCCCTGYACTGGATAAATCGTCAYACAARATAAAAATAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059886 Essential Splice Site 238 333 7 8
Genomic Location:
Chromosome 25 (position 25753935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTCATGGGTGTTTATCTTTGTTTAACATTAATCTTGTTTGTTTTGGC[A/T]GTGCATATGAAGTTATTAAGCTGAAGGGTTACACTTCTTGGGCTATTGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Amyloid A Levels: Genome-wide association study identifies two novel regions at 11p15.5-p13 and 1p31 with major impact on acute-phase serum amyloid A. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8mu1uvu6