si:ch211-197i12.3

Ensembl ID:
ENSDARG00000040853
ZFIN ID:
ZDB-GENE-050208-765
Description:
Leucine-rich repeat protein SHOC-2 [Source:UniProtKB/Swiss-Prot;Acc:Q1L8Y7]
Human Orthologue:
SHOC2
Human Description:
soc-2 suppressor of clear homolog (C. elegans) [Source:HGNC Symbol;Acc:15454]
Mouse Orthologue:
Shoc2
Mouse Description:
soc-2 (suppressor of clear) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:1927197]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37545 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24200 Essential Splice Site Available for shipment Available now
sa37544 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37545
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059882 Essential Splice Site 303 561 4 9
ENSDART00000125215 Essential Splice Site 303 561 3 8
Genomic Location (Zv9):
Chromosome 22 (position 32304636)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29665766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGAAGAGCTCAACCTTGAAAACAACAACATCTCGGTTTTACCAGAGG[T/C]AAGGGTTGCTTTTCCTCAGTCCAGCTGATAATTATTATCATGCTTGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24200
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059882 Essential Splice Site 366 561 5 9
ENSDART00000125215 Essential Splice Site 366 561 4 8
Genomic Location (Zv9):
Chromosome 22 (position 32304348)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29665478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTGGCATTTTCTCTCGAGCAAAAGTGCTTAGCAAGCTCAATATGAAG[G/A]TGAGAGCACAAAAATTGTGGAGAGTGTAAAGTAAGGACACCAGCCTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059882 Nonsense 481 561 8 9
ENSDART00000125215 Nonsense 481 561 7 8
Genomic Location (Zv9):
Chromosome 22 (position 32286638)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29647768
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGCCGAGAGGAATCGGTCACCTGACCAACCTGACGTACCTGGGCTTG[G/T]GAGAGAACCTGCTGCAGCACCTTCCCGAGGAGATCGGTACGGTCCTCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link