si:ch73-105b23.3

Ensembl ID:
ENSDARG00000040851
ZFIN ID:
ZDB-GENE-081028-42
Description:
Novel protein similar to vertebrate pleckstrin homology domain containing, family H (With MyTH4 doma
Human Orthologue:
PLEKHH2
Human Description:
pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 [Source:HGNC Symbol;Acc
Mouse Orthologue:
Plekhh2
Mouse Description:
pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 Gene [Source:MGI Symbol

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11675 Nonsense Available for shipment Available now
sa22227 Nonsense Available for shipment Available now
sa22226 Essential Splice Site Available for shipment Available now
sa6286 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11675
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059881 Nonsense 115 1455 4 32
ENSDART00000142936 Nonsense 115 178 5 7
ENSDART00000144553   None 1090 None 23
Genomic Location (Zv9):
Chromosome 13 (position 8242148)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8544668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAANTCCATTTAAATATGGATATTATTCCATTTTACAGAAACAGAAT[C/T]GAATYCAAGATGCCAGGACTGTGGAAGAAAAAGCAGCCAAAATTAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059881 Nonsense 611 1455 13 32
ENSDART00000142936   None 178 None 7
ENSDART00000144553 Nonsense 249 1090 4 23
Genomic Location (Zv9):
Chromosome 13 (position 8235674)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8538194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGAATTTCAGTCTAATTCTGGAGAGGATGAAAAAGCCCAGACTTCT[G/T]GATCAGAGTCACATAAGAGCCACAGGAGCTCCCACTCCTTTAAGAGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22226
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059881 Essential Splice Site 819 1455 19 32
ENSDART00000142936   None 178 None 7
ENSDART00000144553 Essential Splice Site 457 1090 10 23
Genomic Location (Zv9):
Chromosome 13 (position 8228430)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8530950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGTATGACATTTGTACGTTCATGCATTAATATCAAATTTCCCTACTC[A/T]GTTTCCCCTAGGTCAAATCAAAATGTGGGAGGCCCGTGTGGAGGAAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059881 Nonsense 1299 1455 29 32
ENSDART00000142936   None 178 None 7
ENSDART00000144553 Nonsense 934 1090 20 23
Genomic Location (Zv9):
Chromosome 13 (position 8216417)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8518937
KASP Assay ID:
554-5455.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCACACGTTGGGCATCTCTGAGAGGTCAGACTTCATCRGAGTGCATA[C/T]GAATCTACTTGACAGTGGCTCGCAAGTGGTCATTTTTCGGAGCCAAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link