adra2a

Ensembl ID:
ENSDARG00000040841
ZFIN ID:
ZDB-GENE-021010-1
Description:
Alpha-2A adrenergic receptor [Source:UniProtKB/Swiss-Prot;Acc:Q90WY4]
Human Orthologue:
ADRA2A
Human Description:
adrenergic, alpha-2A-, receptor [Source:HGNC Symbol;Acc:281]
Mouse Orthologue:
Adra2a
Mouse Description:
adrenergic receptor, alpha 2a Gene [Source:MGI Symbol;Acc:MGI:87934]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24199 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059869 Nonsense 130 388 2 2
Genomic Location:
Chromosome 22 (position 32275252)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCCATCAGTCTGGACAGGTACTGGTCAATTACGCAAGCCATCGAGTA[C/A]AACCTGAAGCGAACACCGCAACGTATTAAGCGTATCATTTTTATCGTTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u5ow3o1k