adra2a

Ensembl ID:
ENSDARG00000040841
ZFIN ID:
ZDB-GENE-021010-1
Description:
Alpha-2A adrenergic receptor [Source:UniProtKB/Swiss-Prot;Acc:Q90WY4]
Human Orthologue:
ADRA2A
Human Description:
adrenergic, alpha-2A-, receptor [Source:HGNC Symbol;Acc:281]
Mouse Orthologue:
Adra2a
Mouse Description:
adrenergic receptor, alpha 2a Gene [Source:MGI Symbol;Acc:MGI:87934]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43873 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24199 Nonsense Mutation detected in F1 DNA During 2016
sa39378 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059869 Essential Splice Site None 388 1 2
Genomic Location:
Chromosome 22 (position 32276130)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAGATGCCTTAATAAGTTTGTGGAAAGCTTCAGGCTTATTTCATTAAG[G/A]TAAGGTACATCCCTGTCTTACTTTTTTTTTGGTTGTGTAATTTTGTGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24199
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059869 Nonsense 130 388 2 2
Genomic Location:
Chromosome 22 (position 32275252)
KASP Assay ID:
2261-6996.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCCATCAGTCTGGACAGGTACTGGTCAATTACGCAAGCCATCGAGTA[C/A]AACCTGAAGCGAACACCGCAACGTATTAAGCGTATCATTTTTATCGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059869 Nonsense 277 388 2 2
Genomic Location:
Chromosome 22 (position 32274812)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAATCCTTGCTCCCTCAAGAAGAAAAGCTCAAAAGGAAAGACCAAGT[T/A]GAGCCAAATCAAACCAGGCGATGGAGACAAAACCGAGGCCTGCCAGACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link