rp42-pen

Ensembl ID:
ENSDARG00000040838
ZFIN ID:
ZDB-GENE-020416-2
Description:
DCN1-like protein 2 [Source:RefSeq peptide;Acc:NP_991101]
Human Orthologue:
DCUN1D2
Human Description:
DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) [Source:HGNC Symbol;Acc
Mouse Orthologue:
Dcun1d2
Mouse Description:
DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae) Gene [Source:MGI Symbol

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13703 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13703
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059861 Nonsense 62 259 2 7
ENSDART00000131908 Nonsense 47 210 2 6
ENSDART00000136812 Nonsense 47 205 2 6
ENSDART00000140563 Nonsense 102 267 1 5
Genomic Location:
Chromosome 9 (position 35915497)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGAACCCAGATTTGTACCACAAGGAATCCATGAAAAGCTCAGTGGAC[C/T]GAAAGAAGCTGGAGCAGCTTTACAATCGATATAAAGGTGAGGTTTCTTTW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fpccdqkb