ncf4

Ensembl ID:
ENSDARG00000040812
ZFIN ID:
ZDB-GENE-041124-1
Description:
neutrophil cytosol factor 4 [Source:RefSeq peptide;Acc:NP_991274]
Human Orthologue:
NCF4
Human Description:
neutrophil cytosolic factor 4, 40kDa [Source:HGNC Symbol;Acc:7662]
Mouse Orthologue:
Ncf4
Mouse Description:
neutrophil cytosolic factor 4 Gene [Source:MGI Symbol;Acc:MGI:109186]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39377 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32408 Nonsense Available for shipment Available now
sa43872 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032757 Essential Splice Site 39 156 2 11
ENSDART00000059820 Essential Splice Site 39 355 2 10
ENSDART00000133409   None 259 None 8
Genomic Location (Zv9):
Chromosome 22 (position 31779224)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29258302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCAACTATTGCTGATATCGAGGAGAAGAAAGGTTTCATTGTTTACTTT[G/A]TGAGTTTCCCTAGACCTGAACCCCCGGCACTTCAGCTTTCCTCCAGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032757 Nonsense 54 156 3 11
ENSDART00000059820 Nonsense 54 355 3 10
ENSDART00000133409   None 259 None 8
Genomic Location (Zv9):
Chromosome 22 (position 31781531)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29260609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGCAGAGTTTCGTGATTGAGGTGAAGACCAAAGGCAACAGTAAATACT[T/A]AATCTACAGAAGGTATCGAGAGTTCTTTGCTCTGCACCAGAGTTTGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000032757   None 156 11 11
ENSDART00000059820 Nonsense 331 355 10 10
ENSDART00000133409 Nonsense 237 259 8 8
Genomic Location (Zv9):
Chromosome 22 (position 31822603)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 29301681
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTCGTTCTCATGGTGCAAGAGAGCAAACGCACTGAGTCAAAGGTCAAA[C/T]GACCCGTCAATCAGTTTCCCTGGGAGCTGCTGGTCACGCATGCCAAAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Atopic dermatitis: Meta-analysis of genome-wide association studies identifies three new risk loci for atopic dermatitis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link