lactb

Ensembl ID:
ENSDARG00000040803
ZFIN ID:
ZDB-GENE-020111-1
Description:
serine beta-lactamase-like protein LACTB, mitochondrial [Source:RefSeq peptide;Acc:NP_001018429]
Human Orthologue:
LACTB
Human Description:
lactamase, beta [Source:HGNC Symbol;Acc:16468]
Mouse Orthologue:
Lactb
Mouse Description:
lactamase, beta Gene [Source:MGI Symbol;Acc:MGI:1933395]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4309 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059800 Nonsense 375 536 6 6
Genomic Location:
Chromosome 25 (position 33875624)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAGATTCTACCACTTCAACAAAAAGGGCCGTGTTGTGAACTGCCCGTA[T/A]GTGGACAACTCCTACAAATGGGCYGGCGGAGGTTTCCTGTCAACCGCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rty6wqjm