MED16

Ensembl ID:
ENSDARG00000040779
Description:
mediator complex subunit 16 [Source:HGNC Symbol;Acc:17556]
Human Orthologue:
MED16
Human Description:
mediator complex subunit 16 [Source:HGNC Symbol;Acc:17556]
Mouse Orthologue:
Med16
Mouse Description:
mediator complex subunit 16 Gene [Source:MGI Symbol;Acc:MGI:2158394]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14925 Essential Splice Site Available for shipment Available now
sa38833 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14925
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059752 Essential Splice Site 154 847 3 14
Genomic Location (Zv9):
Chromosome 11 (position 14349383)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14050679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTCATGGTTACACAATGGAGTCAAACTCGCCCTGCATGTTGAAAAGG[T/C]AYAGTATGTGAATTYCCTTMCCTGCCACTGTTACTTTTGGCTTGCTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059752 Nonsense 804 847 13 14
Genomic Location (Zv9):
Chromosome 11 (position 14384024)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 14085320
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCGATGTTTACATCTGGGCATCTCTCCAACCGAGGATAGCAAAGCTTG[C/A]ACAAGGTATCACATTAGAATTATTCCTCTAATTAATTTAAAGTAATTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link