inhbb

Ensembl ID:
ENSDARG00000040777
ZFIN ID:
ZDB-GENE-990415-2
Description:
inhibin, beta B precursor [Source:RefSeq peptide;Acc:NP_571143]
Human Orthologue:
INHBB
Human Description:
inhibin, beta B [Source:HGNC Symbol;Acc:6067]
Mouse Orthologue:
Inhbb
Mouse Description:
inhibin beta-B Gene [Source:MGI Symbol;Acc:MGI:96571]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa70 Stop Lost Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa70
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Stop Lost
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059753 Stop Lost 394 393 2 2
Genomic Location (Zv9):
Chromosome 9 (position 38025801)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 37163697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCAAACGTGACGTGCCTAACATGATCGTGGAGGAGTGCGGCTGTGCC[T/A]GAACAAAATCCATGTTAGGACAGCAGTGACAGTCATATTTATGGTCTTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link