LOC562001

Ensembl ID:
ENSDARG00000040701
Human Orthologues:
KCNJ3, KCNJ5, KCNJ6, KCNJ9
Human Descriptions:
potassium inwardly-rectifying channel, subfamily J, member 3 [Source:HGNC Symbol;Acc:6264]
potassium inwardly-rectifying channel, subfamily J, member 5 [Source:HGNC Symbol;Acc:6266]
potassium inwardly-rectifying channel, subfamily J, member 6 [Source:HGNC Symbol;Acc:6267]
potassium inwardly-rectifying channel, subfamily J, member 9 [Source:HGNC Symbol;Acc:6270]
Mouse Orthologues:
Kcnj3, Kcnj5, Kcnj6, Kcnj9
Mouse Descriptions:
potassium inwardly-rectifying channel, subfamily J, member 3 Gene [Source:MGI Symbol;Acc:MGI:104742]
potassium inwardly-rectifying channel, subfamily J, member 5 Gene [Source:MGI Symbol;Acc:MGI:104755]
potassium inwardly-rectifying channel, subfamily J, member 6 Gene [Source:MGI Symbol;Acc:MGI:104781]
potassium inwardly-rectifying channel, subfamily J, member 9 Gene [Source:MGI Symbol;Acc:MGI:108007]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16099 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059630 Nonsense 32 335 1 2
Genomic Location:
Chromosome 15 (position 36123709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAAGATGGGAAATGCCGAGTAGACTTGGCACACATGGCAGAAAAGGAG[C/T]GMTTTCTGGCRGACATCTTCACTTCGTTTGTGGACCTCCAGTATAGATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cip73d7u