LOC100331474

Ensembl ID:
ENSDARG00000040683
Human Orthologue:
MEP1B
Human Description:
meprin A, beta [Source:HGNC Symbol;Acc:7020]
Mouse Orthologue:
Mep1b
Mouse Description:
meprin 1 beta Gene [Source:MGI Symbol;Acc:MGI:96964]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5711 Nonsense F2 line generated During 2014
sa2075 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5711
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082091 Nonsense 597 774 12 14
ENSDART00000082091 Nonsense 597 774 12 14
Genomic Location:
Chromosome 2 (position 305910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCCCCGTGTACCTGACCCAGGCCAGAGCCCTGAGCCGGGACTTCATC[A/T]AGGGTGGAGACGCCATATTCCTGCTCACCATGGAGGGTGAGCGCCGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2075
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082091 Nonsense 597 774 12 14
ENSDART00000082091 Nonsense 597 774 12 14
Genomic Location:
Chromosome 2 (position 305910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACCCCCGTGTACCTGACCCAGGCCAGAGCCCTGAGCCGGGACTTCATC[A/T]AGGGTGGAGACGCCATATTCCTGCTCACCATGGAGGGTGAGCGCCGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x8gadgx5