ccdc93

Ensembl ID:
ENSDARG00000040678
ZFIN ID:
ZDB-GENE-060421-8315
Description:
coiled-coil domain-containing protein 93 [Source:RefSeq peptide;Acc:NP_001035414]
Human Orthologue:
CCDC93
Human Description:
coiled-coil domain containing 93 [Source:HGNC Symbol;Acc:25611]
Mouse Orthologue:
Ccdc93
Mouse Description:
coiled-coil domain containing 93 Gene [Source:MGI Symbol;Acc:MGI:1918079]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3701 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059574 Essential Splice Site 135 633 4 23
Genomic Location:
Chromosome 9 (position 39418862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATCAGATCCAAGGGTTGGATTTTATCCACATCTTTCCTGTTGTACAG[G/A]TATGGACTATTGTACATCTACTGCARGGGTCCCAAAATTTTCWGCCYGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hk8sx3ao