ctdsp1

Ensembl ID:
ENSDARG00000040674
ZFIN ID:
ZDB-GENE-050522-523
Description:
carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1 [Source:RefSeq peptide;
Human Orthologue:
CTDSP1
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 [Source:HGNC Sym
Mouse Orthologue:
Ctdsp1
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene [Source:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5558 Nonsense Mutation detected in F1 DNA During 2014
sa3740 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18259 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5558
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100226 Nonsense 86 265 3 7
Genomic Location:
Chromosome 9 (position 42794345)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATGTCCTTGAACTTTTATTACAGGTCCCAGCCAAACCACTTCTTCCA[C/T]AGATAAAGTCTAAAGATGTAGGGAAGATCTGCGTAGTAATTGATCTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100226 Essential Splice Site 223 265 6 7
Genomic Location:
Chromosome 9 (position 42809768)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTGTGGACAACTCGCCAGCCTCCTACATATTCCACCCAGACAATGCTG[T/A]ACGTTACTGCCTTTCTTTGTTCTGTGGCACTAATGCGCTTATTACTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100226 Nonsense 255 265 7 7
Genomic Location:
Chromosome 9 (position 42812606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATCTCATCCCGTTTTTCGAGAGACYGAGTAAAGTGGATAACGTCTA[C/A]ACTGTRCTCAAGCAGCAGAGGACTACTAGTTAGCATGACWCTAAAAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lelpl3r9