ctdsp1

Ensembl ID:
ENSDARG00000040674
ZFIN ID:
ZDB-GENE-050522-523
Description:
carboxy-terminal domain RNA polymerase II polypeptide A small phosphatase 1 [Source:RefSeq peptide;
Human Orthologue:
CTDSP1
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 [Source:HGNC Sym
Mouse Orthologue:
Ctdsp1
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1 Gene [Source:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18259 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100226 Nonsense 255 265 7 7
Genomic Location (Zv9):
Chromosome 9 (position 42812606)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41937776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATCTCATCCCGTTTTTCGAGAGACYGAGTAAAGTGGATAACGTCTA[C/A]ACTGTRCTCAAGCAGCAGAGGACTACTAGTTAGCATGACWCTAAAAGCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link