mki67ip

Ensembl ID:
ENSDARG00000040666
ZFIN ID:
ZDB-GENE-021231-4
Description:
MKI67 FHA domain-interacting nucleolar phosphoprotein [Source:UniProtKB/Swiss-Prot;Acc:Q8JIY8]
Human Orthologue:
MKI67IP
Human Description:
MKI67 (FHA domain) interacting nucleolar phosphoprotein [Source:HGNC Symbol;Acc:17838]
Mouse Orthologue:
Mki67ip
Mouse Description:
Mki67 (FHA domain) interacting nucleolar phosphoprotein Gene [Source:MGI Symbol;Acc:MGI:1915199]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41483 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41483
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059549 Nonsense 143 269 4 6
ENSDART00000133060 Nonsense 100 145 3 3

The following transcripts of ENSDARG00000040666 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 39213240)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38351136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAAAGCTCTTTGTCGGCTCTATTGCTGGCTTCAAGAAGCCAAAGTA[T/A]CCTGCAGTGACTCGGTATAACAAAACACACACAGAAGATGATGTGAAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link