gps1

Ensembl ID:
ENSDARG00000040650
ZFIN ID:
ZDB-GENE-041111-240
Description:
COP9 signalosome complex subunit 1 [Source:RefSeq peptide;Acc:NP_001071227]
Human Orthologue:
GPS1
Human Description:
G protein pathway suppressor 1 [Source:HGNC Symbol;Acc:4549]
Mouse Orthologue:
Gps1
Mouse Description:
G protein pathway suppressor 1 Gene [Source:MGI Symbol;Acc:MGI:2384801]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33237 Essential Splice Site Available for shipment Available now
sa11784 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33237
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059506 Essential Splice Site 310 487 9 14
ENSDART00000141106 Essential Splice Site 313 490 9 14

The following transcripts of ENSDARG00000040650 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 36238482)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36109766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTACGTTTGACAGACAGGAATTGCAGCGAAATGTCATCTCAAGCAGG[T/C]GAATTTAAATGTTTAGCATTTGCAGTCTCTTTATATATGAGGTATATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11784
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059506 Essential Splice Site 345 487 10 14
ENSDART00000141106 Essential Splice Site 348 490 10 14

The following transcripts of ENSDARG00000040650 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 36238272)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 36109556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAYGAGTCAAAGTATGCATCTTGTCTGAAAATGCTGGATGAAATGAAG[G/A]TAAGATTGACTAAGCAGAGTTTCAGATAGTRATTTCTGTCTCTTGTRGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link