prickle1a

Ensembl ID:
ENSDARG00000040649
ZFIN IDs:
ZDB-GENE-030724-5, ZDB-GENE-030724-5
Description:
prickle-like 1 (Drosophila) a [Source:RefSeq peptide;Acc:NP_899185]
Human Orthologue:
PRICKLE1
Human Description:
prickle homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:17019]
Mouse Orthologue:
Prickle1
Mouse Description:
prickle homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1916034]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059514 Nonsense 596 793 8 8
ENSDART00000101851 Nonsense 596 793 7 7
Genomic Location (Zv9):
Chromosome 25 (position 386210)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 294848
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATGAAGAGCCTGACGTCTGATCTGGACCGAACTCAAGTGATAGAGGAA[C/T]AGCAGGAGCAGGGCGTACCGAGCCCTGAGGTACACCCCAAACCACCGCGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link