LOC561540

Ensembl ID:
ENSDARG00000040627
Human Orthologue:
GRIK1
Human Description:
glutamate receptor, ionotropic, kainate 1 [Source:HGNC Symbol;Acc:4579]
Mouse Orthologue:
Grik1
Mouse Description:
glutamate receptor, ionotropic, kainate 1 Gene [Source:MGI Symbol;Acc:MGI:95814]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11428 Essential Splice Site Available for shipment Available now
sa22721 Nonsense Mutation detected in F1 DNA During 2014
sa8819 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa11428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031793 Essential Splice Site 287 906 5 16
Genomic Location:
Chromosome 15 (position 41178329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAATGGGCATGATGACCGAATACTAMCACTTCTTCTTTACCACTCTGG[T/C]AAGTTTCCTATATTCTKTSTTTGTGTGTTTGTCCACAAGTTTTTATATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031793 Nonsense 431 906 9 16
Genomic Location:
Chromosome 15 (position 41189925)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGATCATACATGTCAATGTGGCCTTTCTGTTTTCTCTTCACAAGCCGT[T/A]GGAGAGCGGCCGTTTTAACAAAGTGTGGAAGAAGGTTGGTATTAAACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031793 Nonsense 742 906 15 16
Genomic Location:
Chromosome 15 (position 41204993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGCTCTGAYGCTTTCATTGGTYTGCAGAAGTCRAAGATCTCTACATA[T/A]GAGAAGATGTGGGCGTTCATGAGCAGCCGGAAGAACACAGCRTTGGTRAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sf4g5jx9