LOC568699

Ensembl ID:
ENSDARG00000040610
Human Orthologue:
SLC7A11
Human Description:
solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 [Source:HGNC Symbol;
Mouse Orthologue:
Slc7a11
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 11 Gene [Source:MGI Sym

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20198 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20198
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059440 Essential Splice Site 238 476 7 12
Genomic Location:
Chromosome 4 (position 5678146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCTTTAAATATTTGTCATTATTTTTTATATTTCATATATTGTTCTC[A/C]GGACCGTCCCATTGGCCATCATTTTCTCCATGGTGACTGTTACTGTGTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zeodk031