tfap2c

Ensembl ID:
ENSDARG00000040606
ZFIN ID:
ZDB-GENE-041212-61
Description:
transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) [Source:RefSeq peptid
Human Orthologue:
TFAP2C
Human Description:
transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma) [Source:HGNC Symbol;Ac
Mouse Orthologue:
Tcfap2c
Mouse Description:
transcription factor AP-2, gamma Gene [Source:MGI Symbol;Acc:MGI:106032]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18857 Nonsense Mutation detected in F1 DNA During 2014
sa3617 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059435 Nonsense 325 445 6 8
ENSDART00000059435 Nonsense 325 445 6 8
Genomic Location:
Chromosome 6 (position 56143305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGATTTTGGGTATGTCTGTGAAACGGAGTTTCCCGCGAAGGCCATTGCT[G/T]AATATCTTGGCCGACCACATGTGGAACGCAATGAGATCAACTCTCGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059435 Nonsense 325 445 6 8
ENSDART00000059435 Nonsense 325 445 6 8
Genomic Location:
Chromosome 6 (position 56143305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATTTTGGGTATGTCTGTGAAAMGGAGTTTCCCGCGAAGGCCATTGCT[G/T]AATATCTTGGCCGACCACATGTGGAACGCAATGAGATCAACTCTCGCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c7m447cq