c3orf33

Ensembl ID:
ENSDARG00000040582
ZFIN ID:
ZDB-GENE-061121-2
Description:
c3orf33 homolog [Source:RefSeq peptide;Acc:NP_001138268]
Human Orthologue:
C3orf33
Human Description:
chromosome 3 open reading frame 33 [Source:HGNC Symbol;Acc:26434]
Mouse Orthologue:
E130311K13Rik
Mouse Description:
RIKEN cDNA E130311K13 gene Gene [Source:MGI Symbol;Acc:MGI:3607716]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12162 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059400 Nonsense 147 249 4 5

The following transcripts of ENSDARG00000040582 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 32375709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCAACAGCTGAGACCCGCTGAGACRGTTTGGCTCCGACTGATCGCTCGA[C/T]AGAACGAGACCCTYCACTGCCTAGTGTCAGTTAACAAGGTGGGTGAGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gsc7g1k4