C12orf28

Ensembl ID:
ENSDARG00000040581
Description:
chromosome 12 open reading frame 28 [Source:HGNC Symbol;Acc:26316]
Human Orthologue:
C12orf28
Human Description:
chromosome 12 open reading frame 28 [Source:HGNC Symbol;Acc:26316]
Mouse Orthologue:
Gm239
Mouse Description:
predicted gene 239 Gene [Source:MGI Symbol;Acc:MGI:2685085]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44394 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059397 Nonsense 470 890 12 25
Genomic Location (Zv9):
Chromosome Zv9_scaffold3562 (position 92592)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 71165279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCAACGGAACAGCTCAAGAGGATAGCTCAGATGAGGATTGTGGAGTA[C/A]GATTATAGACCAGAGTTTGCCTCAAGGATGGGGATCGACCAATGTCATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link