pdzd3a

Ensembl ID:
ENSDARG00000040568
ZFIN ID:
ZDB-GENE-080430-1
Human Orthologue:
PDZD3
Human Description:
PDZ domain containing 3 [Source:HGNC Symbol;Acc:19891]
Mouse Orthologue:
Pdzd3
Mouse Description:
PDZ domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2429554]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30994 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42543 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059373 Essential Splice Site 179 437 3 7
ENSDART00000059373 Essential Splice Site 179 437 3 7
Genomic Location (Zv9):
Chromosome 15 (position 22815692)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23526879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGGAGTCTCGATTTCTGTCATCTCATATGCAGCACTGGCCAAAATGG[T/A]AAGCGTGCTCCTAATAAATATCTTTTATGGTATTTTATCGGCACATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42543
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059373 Essential Splice Site 179 437 3 7
ENSDART00000059373 Essential Splice Site 179 437 3 7
Genomic Location (Zv9):
Chromosome 15 (position 22815692)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23526879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGGAGTCTCGATTTCTGTCATCTCATATGCAGCACTGGCCAAAATGG[T/A]AAGCGTGCTCCTAATAAATATCTTTTATGGTATTTTATCGGCACATTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link