hnrnpul1

Ensembl ID:
ENSDARG00000040564
ZFIN ID:
ZDB-GENE-040426-2432
Description:
heterogeneous nuclear ribonucleoprotein U-like protein 1 [Source:RefSeq peptide;Acc:NP_998436]
Human Orthologue:
HNRNPUL1
Human Description:
heterogeneous nuclear ribonucleoprotein U-like 1 [Source:HGNC Symbol;Acc:17011]
Mouse Orthologue:
Hnrnpul1
Mouse Description:
heterogeneous nuclear ribonucleoprotein U-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443517]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23344 Nonsense Available for shipment Available now
sa36693 Essential Splice Site Mutation detected in F1 DNA During 2016
sa705 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23344
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059360 Nonsense 506 784 12 16
Genomic Location (Zv9):
Chromosome 18 (position 34156333)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35835489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTTTGTCACTTTGTCTAGACAAATGTATATGGATCAGCCCAGAGA[C/T]GAAAGATGCGCCCTTTTGAAGGGTTTCACCGTAAGGCTGTTGTAATTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059360 Essential Splice Site 687 784 14 16
Genomic Location (Zv9):
Chromosome 18 (position 34154102)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35833258
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTACAATAATAGTCGCTATGGCTCTTATAACAAAGAGGGATATGGTCAA[G/A]TGAGTGCTTTATGTGGCTTATCAGTTTTTATTTGTGACAAATATTTAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059360 Nonsense 746 784 15 16
Genomic Location (Zv9):
Chromosome 18 (position 34150461)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35829617
KASP Assay ID:
554-0613.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGATCTGGACAATCCTACAACCAGCAGAACTATAATCAGCAGTATCAA[C/T]AGGTCAGTTACTGTGAATCCTTTCTGATTTCGAAGAATACTAAAAGTAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link