bckdha

Ensembl ID:
ENSDARG00000040555
ZFIN ID:
ZDB-GENE-050522-376
Description:
2-oxoisovalerate dehydrogenase subunit alpha, mitochondrial [Source:RefSeq peptide;Acc:NP_001019590
Human Orthologue:
BCKDHA
Human Description:
branched chain keto acid dehydrogenase E1, alpha polypeptide [Source:HGNC Symbol;Acc:986]
Mouse Orthologue:
Bckdha
Mouse Description:
branched chain ketoacid dehydrogenase E1, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:107701]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9266 Nonsense Mutation detected in F1 DNA During 2014
sa17364 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059347 Nonsense 32 446 1 8
ENSDART00000125820 Nonsense 32 446 1 9
Genomic Location:
Chromosome 18 (position 34406338)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGCAATTCGTCAAAACACAGCATTWAAAGCAACAACGCTTCTCCAA[C/T]AAAGGGGATTCCGCGTCAATGTAAGTCTTACGTTTATGGCAGCTGCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059347 Nonsense 444 446 8 8
ENSDART00000125820 Nonsense 444 446 8 9
Genomic Location:
Chromosome 18 (position 34420728)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGGAGACACGTCCAGCAATATAAAGAGCATTACCCAMTTGACCACTA[T/A]GAGAAATAATCCATGAGCCATGGACACAACTGGGAAAGKTCTTGCACATR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/98w2n6ug