bckdha

Ensembl ID:
ENSDARG00000040555
ZFIN ID:
ZDB-GENE-050522-376
Description:
2-oxoisovalerate dehydrogenase subunit alpha, mitochondrial [Source:RefSeq peptide;Acc:NP_001019590
Human Orthologue:
BCKDHA
Human Description:
branched chain keto acid dehydrogenase E1, alpha polypeptide [Source:HGNC Symbol;Acc:986]
Mouse Orthologue:
Bckdha
Mouse Description:
branched chain ketoacid dehydrogenase E1, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:107701]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9266 Nonsense Mutation detected in F1 DNA During 2016
sa36694 Nonsense Mutation detected in F1 DNA During 2016
sa17364 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059347 Nonsense 32 446 1 8
ENSDART00000125820 Nonsense 32 446 1 9
Genomic Location (Zv9):
Chromosome 18 (position 34406338)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36085494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGCAATTCGTCAAAACACAGCATTWAAAGCAACAACGCTTCTCCAA[C/T]AAAGGGGATTCCGCGTCAATGTAAGTCTTACGTTTATGGCAGCTGCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059347 Nonsense 358 446 8 8
ENSDART00000125820 Nonsense 358 446 8 9
Genomic Location (Zv9):
Chromosome 18 (position 34420468)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36099624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGACAGCTCTGCCTACCGTTCAGTGGACGAGGTGAACTACTGGGACAAG[C/T]AGGACCACCCCATCTCTCGCCTGCGCCACTACATGACAGCCCGCGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17364
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059347 Nonsense 444 446 8 8
ENSDART00000125820 Nonsense 444 446 8 9
Genomic Location (Zv9):
Chromosome 18 (position 34420728)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36099884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTGGAGACACGTCCAGCAATATAAAGAGCATTACCCAMTTGACCACTA[T/A]GAGAAATAATCCATGAGCCATGGACACAACTGGGAAAGKTCTTGCACATR
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link