sc:d0144

Ensembl ID:
ENSDARG00000040543
ZFIN ID:
ZDB-GENE-080229-4
Description:
transmembrane glycoprotein A33 [Source:RefSeq peptide;Acc:NP_001108577]
Human Orthologues:
C1orf204, GPA33
Human Descriptions:
chromosome 1 open reading frame 204 [Source:HGNC Symbol;Acc:27647]
glycoprotein A33 (transmembrane) [Source:HGNC Symbol;Acc:4445]
Mouse Orthologue:
Gpa33
Mouse Description:
glycoprotein A33 (transmembrane) Gene [Source:MGI Symbol;Acc:MGI:1891703]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059335 Nonsense 335 448 7 7
Genomic Location (Zv9):
Chromosome 1 (position 548592)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 67388
KASP Assay ID:
2259-0032.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGCGCAGCGAGAGGAGCTACGACCGCCGCAGTGACTACGACGACCGC[C/T]GAGATCCGAACACCAGCCAGCGGGATGATCGTGATGACCGATACAATGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link