LOC558675

Ensembl ID:
ENSDARG00000040536
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42617 Nonsense Mutation detected in F1 DNA During 2017
sa32060 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075909 Nonsense 152 536 2 7
Genomic Location (Zv9):
Chromosome 15 (position 40239747)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41756454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATTCAGGAGAACATCTGCCCCAGTCATGGGAGACCGCTGGAGATTTA[C/A]TGTCAGGATGATCATCAGTGTATTTGTTACCTGTGCATGGTTGACAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075909 Nonsense 259 536 4 7
Genomic Location (Zv9):
Chromosome 15 (position 40238742)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 41755449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGAGATTAAAGAGCAGATCAGAGCTCAGGAGAAGACTGAGACAGAT[C/T]GAGCAGAGCAACTTCACCAACATCTGCATCAAGAGCTGACACAACTCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link