LOC793671

Ensembl ID:
ENSDARG00000040535
Human Orthologue:
CSGALNACT1
Human Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 1 [Source:HGNC Symbol;Acc:24290]
Mouse Orthologue:
Csgalnact1
Mouse Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2442354]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44720 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21660 Nonsense Mutation detected in F1 DNA During 2017
sa18977 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059322 Essential Splice Site 260 580 2 7
Genomic Location (Zv9):
Chromosome 10 (position 7358549)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAAAGCTCTCCTTTTCTTCACTGTAGTTGATGTGTTTTCTTTATTGC[A/T]GGGCTTGCGCGCACTGAGAAGGACAAGGGCTCTCTCTATGAGTTGACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059322 Nonsense 365 580 3 7
Genomic Location (Zv9):
Chromosome 10 (position 7350307)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8368553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGGAAAGGACCAGATGAATGAGGTCAAAGGAACCTTAGAGAACACAT[C/A]GAGGTATGGCACATTAATGTTTGTGTGTGTGTGTGTGTGTGTGTGTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059322 Nonsense 428 580 5 7
Genomic Location (Zv9):
Chromosome 10 (position 7329771)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 8348017
KASP Assay ID:
2260-2874.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACATTGTCTTCCTCCTTGTTTTCTTTTTTTTTTTTTTTTAAGGAAAG[A/T]AAGTGTTTTACCCAGTCCTCTTCAGTCAGTATAACCCGGCTGTGATTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link