LOC793671

Ensembl ID:
ENSDARG00000040535
Human Orthologue:
CSGALNACT1
Human Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 1 [Source:HGNC Symbol;Acc:24290]
Mouse Orthologue:
Csgalnact1
Mouse Description:
chondroitin sulfate N-acetylgalactosaminyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2442354]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21660 Nonsense Mutation detected in F1 DNA During 2014
sa18977 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059322 Nonsense 365 580 3 7
Genomic Location:
Chromosome 10 (position 7350307)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGGAAAGGACCAGATGAATGAGGTCAAAGGAACCTTAGAGAACACAT[C/A]GAGGTATGGCACATTAATGTTTGTGTGTGTGTGTGTGTGTGTGTGTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059322 Nonsense 428 580 5 7
Genomic Location:
Chromosome 10 (position 7329771)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACATTGTCTTCCTCCTTGTTTTCTTTTTTTTTTTTTTTTAAGGAAAG[A/T]AAGTGTTTTACCCAGTCCTCTTCAGTCAGTATAACCCGGCTGTGATTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ebluszgm